Skip to main content

Table 1 The sequence of primers used for real time PCR

From: Clinical significance of hyaluronan levels and its pro-osteogenic effect on mesenchymal stromal cells in myelodysplastic syndromes

Prime Forward (5′-3′) Reverse (5′-3′)
GAPDH CCCACTCCTCCACCTTTGA CCACCCTGTTGCTGTAGCC
HAS-1 GGAATAACCTCTTGCAGCAGTTTC TTGGGACCGCTGAAGCC
HAS-2 TCGCAACACGTAACGCAAT ACTTCTCTTTTTCCACCCCATTT
HAS-3 AACAAGTACGACTCATGGATTTCCT GCCCGCTCCACGTTGA
RUNX-2 AGTGGACGAGGCAAGAGTTTC CCTTCTGGGTTCCCGAGGT
ALP CCATTCCCACGTCTTCACATT AAGGGCTTCTTGTCTGTGTCACT
COL-1 CACCAATCACCTGCGTACAGAA CAGATCACGTCATCGCACAAC
BSP GACAGTTCAGAAGAGGAGGAG AGCCCAGTGTTGTAGCAGA
OCN AGGGCAGCGAGGTAGTGAA TCCTGAAAGCCGATGTGGT
OPN TTTACAACAAATACCCAGATGC ATGGCTTTCGTTGGACTTACT