Skip to main content

Advertisement

Table 1 Primer sequences for reverse transcription-quantitative polymerase chain reaction

From: A circRNA–miRNA–mRNA network identification for exploring underlying pathogenesis and therapy strategy of hepatocellular carcinoma

Gene ID Primer sequence Product length (bp)
Forward (5′-3′) Reverse (5′-3′)
ACTB CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT 250
hsa_circRNA_102166 TACGTTGATCACCAAGGGCT CTTCTGCTTTGGCTGTGACA 126
hsa_circRNA_104515 CTTTATAACTATAGGGTACTGG GTCTCCTCTGGTTCATTG 150
hsa_circRNA_105031 ACTACAGGCAATCAGGGTTC GTACAAGTTCTGCAGGAACGA 118
hsa_circRNA_100291 CATTCTTATAGTTGTAAGCTTAG CATAGGAGAAAGCATCATTAT 131
  1. ACTB beta-actin