Skip to main content

Advertisement

Table 2 Primers used for PCR analysis

From: Tanshinone IIA promotes the differentiation of bone marrow mesenchymal stem cells into neuronal-like cells in a spinal cord injury model

Gene Primer sequence (5′-3′)
Rat GFAP F: CGAAGAAAACCGCATCACCA
   R: CATCCTTGTGCTCCTGCTTC
Rat Nestin F: GGCAAATCTGGGAACTGGTA
   R: GACATCAGTGGCTCCTCTCC
Rat NeuN F: ACCCTCCTCCACCTCAGAAT
   R: GTCTGTGCTGCTTCATCTGC
Rat NF200 F: GAGTGGTTCCGAGTGAGATTC
   R: TGCTTTTCAGTGCCTCCAAC
Rat GAPDH F: AAGAAGGTGGTGAAGCAGGC
   R: TCCACCACCCTGTTGCTGTA