Skip to main content

Advertisement

Table1 Primers used for qRT-PCR

From: Endothelial progenitor cells improve the therapeutic effect of mesenchymal stem cell sheets on irradiated bone defect repair in a rat model

Gene Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′)
Runx2 5′ AGA CCA GCA GCA CTC CAT AT 3′ 5′ CTC ATC CAT TCT GCC GCT AGA 3′
Alp 5′ ATG GCT CAC CTG CTT CAC G 3′ 5′ TCA GAA CAG GGT GCG TAG G 3′
Bmp2 5′ ATG GGT TTG TGG TGG AAG TG 3′ 5′ TTG GCT TGA CGC TTT TCT CG 3′
Vegf 5′ AGG AGT ACC CCG ATG AGA TA 3′ 5′ CTT CTA CTG CCC TCC TTG TA 3′
Ocn 5′ AGG GCA GTA AGG TGG TGA AT 3′ 5′ GCA TTA ACC AAC ACG GGG TA 3′
Gapdh 5′ GGCACAGTCAAGGCTGAGAATG3 5′ ATGGTGGTGAAGACGCCAGTA3′