Skip to main content

Table 1 Oligonucleotide primers and PCR conditions for inflammatory response genes

From: Effect of Infla-Kine supplementation on the gene expression of inflammatory markers in peripheral mononuclear cells and on C-reactive protein in blood

Genbank access. # Symbol and description Primers qPCRa (°C)
NM_000576.2 IL1β
Interleukin 1 beta
HsIL1BF: ggagaatgacctgagcacct
HsIL1BR: ggaggtggagagctttcagt
56
NM_000584.3 CXCL8
Interleukin 8
HsIL8F: cagttttgccaaggagtgct
HsIL8R: acttctccacaaccctctgc
58
NM_000594.3 TNF
Tumor necrosis factor
HsTNFF: gtcaacctcctctctgccat
HsTNFR: ccaaagtagacctgcccaga
57
NM_001165412 NFκB
Nuclear factor kappa B
NFκBF: gcacgacaacatctcattgg
NFκBR: tcccaagagtcatccaggtc
58
NM_001017.2 RSP13
Ribosomal protein 13
RPS13F: cgaaagcatcttgagaggaaca
RPS13R: tcgagccaaacggtgaatc
57
NM_000600.3 IL6
Interlukin 6
HsIL6F: agtcctgatccagttcctgc
HsIL6R: aagctgcgcagaatgagatg
56
  1. aInitial denaturation at 98 °C for 30 s, followed by forty cycles of denaturation at 95 °C for 10 s, annealing for 15 s (at temperature given) and extension at 60 °C for 15 s