Skip to main content

Advertisement

Table 1 Oligonucleotide primers and PCR conditions for inflammatory response genes

From: Effect of Infla-Kine supplementation on the gene expression of inflammatory markers in peripheral mononuclear cells and on C-reactive protein in blood

Genbank access. # Symbol and description Primers qPCRa (°C)
NM_000576.2 IL1β Interleukin 1 beta HsIL1BF: ggagaatgacctgagcacct HsIL1BR: ggaggtggagagctttcagt 56
NM_000584.3 CXCL8 Interleukin 8 HsIL8F: cagttttgccaaggagtgct HsIL8R: acttctccacaaccctctgc 58
NM_000594.3 TNF Tumor necrosis factor HsTNFF: gtcaacctcctctctgccat HsTNFR: ccaaagtagacctgcccaga 57
NM_001165412 NFκB Nuclear factor kappa B NFκBF: gcacgacaacatctcattgg NFκBR: tcccaagagtcatccaggtc 58
NM_001017.2 RSP13 Ribosomal protein 13 RPS13F: cgaaagcatcttgagaggaaca RPS13R: tcgagccaaacggtgaatc 57
NM_000600.3 IL6 Interlukin 6 HsIL6F: agtcctgatccagttcctgc HsIL6R: aagctgcgcagaatgagatg 56
  1. aInitial denaturation at 98 °C for 30 s, followed by forty cycles of denaturation at 95 °C for 10 s, annealing for 15 s (at temperature given) and extension at 60 °C for 15 s