Skip to main content

Table 2 qPCR primers

From: Haemoadsorption reduces the inflammatory response and improves blood flow during ex vivo renal perfusion in an experimental model

Gene NCBI accession number Primer sequences
ICAM-1 NM_213816.1 TCAATGTGGCCCCTAAACACC
GTCTCTAGGCCAAAGCTGGT
IL-1β NM_214055.1 CCTTGAAACGTGCAATGATGACT
GCCAGCCAGCACTAGAGATT
IL-6 NM_001252429.1 GGGTTCAATCAGGAGACCTGC
CGGCCTCGACATTTCCCTTA
IL-8 NM_213867.1 AGAGTGGACCCCACTGTGAA
TGTTGTTGCTTCTCAGTTCTCTT
HMGB-1 NM_0010040134.1 GCTCAGAAAGGTGGAAGACCAT
TCATAACGGGCCTTGTCCG
RPL4 XM_005659862.2 TGAGCTCTATGGCACTTGGC
GAATCTTCTTGCGTGGTGCG
TLR4 NM_001113039.2 TCATGCTTTCTCCGGGTCAC
TAGGAACCACCTGCACGCAA