Skip to main content

Advertisement

Table 1 Primer sequences used in quantitative methylation specific PCR for candidate genes

From: Identification of clear cell renal cell carcinoma and oncocytoma using a three-gene promoter methylation panel

Primer set Sense primer sequence (5′–3′) Antisense primer sequence (5′–3′)
MST1R a AGCGTTAGTGTATAGCGGC TAAACAACGATCCCGACA
OXR1 TTCGTTGTATATATCGAACGGT CCGTACTAAATATCTCGTTAACT
HOXA9 TATTTAGTCGGTATTCGC ACCTCGAACGCTTCCAT
  1. a MST1R promoter methylation primers from [14, 25]