Skip to main content

Table 2 Primer sequences

From: Pulsed high-dose dexamethasone modulates Th1-/Th2-chemokine imbalance in immune thrombocytopenia

Target gene Forward (5′-3′) Reverse (5′-3′)
CCL5 CAGAGAAGAAATGGGTTCGGGA GAGCGGGTGGGGTAGGATAGTG
CXCL11 GCCTTGGCTGTGATATTGTGTGC CATCGTTGTCCTTTATTTTCTTT
CCL11 TCAGCGACTAGAGAGCTACAGGA GCTTTGGAGTTGGAGATTTTTGG
CCR3 TACACAGGAATCATCAAAACGC AGGAAGAGAGAAGGATAGCCAC
CXCR3 CAACGCCACCCACTGCCAATAC CAAAGGCCACCACGACCACCAC
CCR5 GAAGAGCTGAGACATCCGTTCC ACACCAG TGAGTAGAGCGGAG
β-actin CACTCTTCCAGCCTTCCTTCC AGGTCTTTGCGGATGTCCAC