Skip to main content

Table 2 Primers used in qRT-PCR

From: HBx-induced MiR-1269b in NF-κB dependent manner upregulates cell division cycle 40 homolog (CDC40) to promote proliferation and migration in hepatoma cells

Name Primer sequence
U6 RT primer 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAAC-3′
miR-1269b RT primer 5′-GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACCCAGTAGC-3′
U6 forward 5′-TGCGGGTGCTCGCTTCGGCAGC-3′
U6 reverse 5′-CCAGTGCAGGGTCCGAGGT-3′
miR-1269b forward 5′- TGCGCTGGACTGAGCCATGC-3′
pre-miR-1269b-qPCR-S 5′-CAGGCTGGGAGAAAGACC-3′
pre-miR-1269b-qPCR-AS 5′-GGAAGTTGGCTCACATAATC-3′
pre-miR-1269a-qPCR-S 5′ TGGATTGCCTAGACCAGGG 3′
pre-miR-1269a-qPCR-AS 5′ GCTGGAGACCAGGGAAGCCAG 3′
CDC40-qPCR-S 5′-GTATGCTCCTTGCCCTTACGG-3′
CDC40-qPCR-AS 5′-AATGGCAGCAGCTAGGCAAT-3′
β-actin-qPCR-S 5′-CGTGACATTAAGGAGAAGCTG-3′
β-actin-qPCR-AS 5′-CTAGAAGCATTTGCGGTGGAC-3′