Skip to main content

Table 1 The oligonucleotide primers used for PCR amplification

From: Effects of hydrogen-rich saline on early acute kidney injury in severely burned rats by suppressing oxidative stress induced apoptosis and inflammation

Gene Genbank accession Primer sequences (5′–3′) Size (bp) Annealing (°C)
Rat TNF-α NM_012675.3 GCCACCACGCTCTTCTGTCTACTG
TGGGCTACGGGCTTGTCACTC
152 64
Rat IL-1β NM_031512.2 GCTTTCGACAGTGAGGAGAATGAC
CTGCTGTGAGATTTGAAGCTGGAT
126 64
Rat IL-6 NM_012589.2 TGACAGCCACTGCCTTCCCTAC
CAATCAGAATTGCCATTGCACAA
169 64
Rat IL-10 NM_012854.2 GCACTGCTATGTTGCCTGCTCTT
GAGCATGTGGGTCTGGCTGACT
111 64
Rat ICAM-1 NM_012967.1 CACAAACGACGCTTCTTTTGCTCT
CCCCTCTTGCCAGGTCCAGTT
144 64
Rat 18S (reference substance) M11188 GAATTCCCAGTAAGTGCGGGTCATA 105 64