Skip to main content

Table 1 Primers for quantitative real-time PCR

From: Enhanced expression of cohesin loading factor NIPBL confers poor prognosis and chemotherapy resistance in non-small cell lung cancer

  Primer
NIPBL-F AGCAGAGACCTGATGGGCGA
NIPBL-R TGTCGCTCTGATTCACCCCTG
STAT3-F TGACGGAGAAGCAGCAGATG
STAT3-R TCCTGGAGATTCTCTACCACTT
Mcl-1-F GAGACCTTACGACGGGTTGG
Mcl-1-R GAGAGTCACAATCCTGCCCC
c-Myc-F CGGGTAGTGGAAAACCAGCA
c-Myc-R AGAAATACGGCTGCACCGAG
Beta actin-F TGGCACCCAGCACAATGAA
Beta actin-R CTAAGTCATAGTCCGCCTAGAAGCA