Skip to main content

Table 1 Primer sequences of Wnt pathway and EMT associated genes

From: FH535 increases the radiosensitivity and reverses epithelial-to-mesenchymal transition of radioresistant esophageal cancer cell line KYSE-150R

Target gene Forward primer (5′-3′) Reverse primer (5′-3)
β-actin AAAGACCTGTACGCCAACAC GTCATACTCCTGCTTGCTGAT
GAPDH TCCCATCACCATCTTCCAGG GATGACCCTTTTGGCTCCC
Cyclin D1 GCATCTACACCGACAACTCCA GGCACAGAGGGCAACGA
E-cadherin GAGAACGCATTGCCACATACA GCGATGGCGGCATTGTA
Vimentin CCAGATGCGTGAAATGGAA TGGGTATCAACCAGAGGGAGT
Snail CCCAATCGGAAGCCTAACTAC AGCCTTTCCCACTGTCCTCA
Slug TCCTGGTCAAGAAGCATTTCA GGAGCAGCGGTAGTCCACA
Twist CATGTCCGCGTCCCACTAG CCACGCCCTGTTTCTTTGA
GSK3β TGGCTACCATCCTTATTCCTCC CCACGGTCTCCAGTATTAGCATC
FZD1 AAACAGCACAGGTTCTGCAAAA TGGGCCCTCTCGTTCCTT
FZD2 TCCATCTGGTGGGTGATTCTG CTCGTGGCCCCACTTCATT
FZD3 GCCTATAGCGAGTGTTCAAAACTCA TGGAAACCTACTGCACTCCATATCT
FZD4 GCCCCAGAACGACCACAA GGGCAAGGGAACCTCTTCAT
β-catenin GCCAAGTGGGTGGTATAGAGG GCGGGACAAAGGGCAAGA