Skip to main content

Table 1 Primers for RT-PCR

From: Caulerpa lentillifera extract ameliorates insulin resistance and regulates glucose metabolism in C57BL/KsJ-db/db mice via PI3K/AKT signaling pathway in myocytes

Description Gene bank Sense primer (5′ → 3′) Anti-sense primer (5′ → 3′)
GCK NM_009204.2 CCTGCCCGAAAGAGTCTAAAGC ACTAAGAGCACCGAGACCAACG
G-6Pase NM_010292.5 TTCACCTTCTCCTTCCCTGTAAGG TACCAGCTTGAGCAGCACAAGTCG
PEPCK NM_008061.3 AAGACTCCCAGGACTGGTTCAT TAGCAGGTAGAATCCAAGCGCG
GLUT4 NM_009204.2 CCTGCCCGAAAGAGTCTAAAGC ACTAAGAGCACCGAGACCAACG
β-actin NM_009609.2 TGCCCATCTATGAGGGTTACG TAGAAGCATTTGCGGTGCACG