Skip to main content

Table 1 Primers of DR3, PDCD5, p53 and FasL for MSP

From: Therapeutic effect of daphnetin on the autoimmune arthritis through demethylation of proapoptotic genes in synovial cells

Target gene Sense sequence(5'-3') Antisense sequence(5'-3')
DR3(M) GAGGGTTTAGGGGAGTTTTTTAAC AAAACCTATACTTCCTCTCAACGAA
DR3(U) GGGTTTAGGGGAGTTTTTTAATGT AAAACCTATACTTCCTCTCAACAAA
PDCD5(M) AAATTGTTAAAGATATTTAATGCGT TAAAATCTACCAATCCAAAAACGAC
PDCD5(U) AAATTGTTAAAGATATTTAATGTGT TAAAATCTACCAATCCAAAAACAAC
p53(M) GCGAAGGTAGGAGTTTTAAGAGTAC CACTATTTACGAAACAACCCGAC
p53(U) TGGTGAAGGTAGGAGTTTTAAGAGTAT AACACTATTTACAAAACAACCCAAC
FasL(M) ATTTAGGAGAATTAGTAGTTGGGGC TAAAATAAACACCTTACCTCTCTCG
FasL(U) TTTAGGAGAATTAGTAGTTGGGGTG CTAAAATAAACACCTTACCTCTCTCAC