Skip to main content

Table 1 Primer sequences

From: AAV2/8-hSMAD3 gene delivery attenuates aortic atherogenesis, enhances Th2 response without fibrosis, in LDLR-KO mice on high cholesterol diet

GENE polarity 5’ 3’
βactin sense ATCTGGCACCACACCTTCTAC
  antisense GAAGGTCTCAAACATGATCTGG
COL1A2 sense CGTTCCCAAAGATGGTAGAT
  antisense AGCCACCTCCGCTGACACCA
COL2A1 sense GAACATCACCTACCTACCACTG
  antisense ATCCTTCAGGGCAGTGTA
CTGF sense GGAGAAGCAGAGCCGCCT
  antisense CTGGTGCAGCCAGAAAGC
EMR sense AAGTATTCCAACTGCTCT
  antisense ATTGGCCCTCCTCCACTA
IL-4 sense ATGTGCCAAACGTCCTCACA
  antisense AGAACACTAGAGTTCTTCTT
IL-7 sense AAATGACAGGAACTGATAGT
  antisense GACATTGAATTCTTCACTGA
IL-10 sense TACAGCCGGGAAGACAATAA
  antisense AAGGAGTCGGTTAGCAGTAT
IL-12 sense AGAATCACAACCATCAGCAG
  antisense TTCACTCTGTAAGGGTCTGC
ITGAM sense TCCAGAGGCTGTGAATAT
  antisense CTTCTGAAAGTCAATGTTGT
SMAD3 sense GGTCCCTGGATGGCCGGT
  antisense GGATTCACGCAGACCTCG
  1. Shown are the indicated primer sets used to analyze gene expression by QRT-PCR.