Skip to main content

Advertisement

Table 1 The sequences of the primers

From: Rapamycin protects kidney against ischemia reperfusion injury through recruitment of NKT cells

Gene name   Primer sequence
CXCL9 Sense TCC TTTTGGGCATCATCTTC
  Antisense TTCCCCCTCTTTTGCTTTTT
CXCL10 Sense ACTGCATCCATATCGATGAC
  Antisense TTCATCGTGGCAATGATCTC
CXCL12 Sense TGCATTTATAGCATACGGTATGA
  Antisense GCGTTAATAAGGATTGCCATTT
CXCL13 Sense GAGGCAGATGGAACTTGAGC
  Antisense CTGGGGATCTTCGAATGCTA
CXCL16 Sense CTGACTCAGCCAGGCAATGG
  Antisense TGAGTGGACTGCAAGGTGGA
CCL21 Sense CCAAGTTTAGGCTGTCCCATC
  Antisense GGGCTACTGGGCTATCCTCT
GAPDH Sense TATGAGGAACCGCATCGCTG
  Antisense TAGCATGAGTTGGCACCCACTG