Skip to main content

Table 1 Oligonucleotides used for Real-Time PCR

From: Peritoneal carcinomatosis from ovarian cancer: chemosensitivity test and tissue markers as predictors of response to chemotherapy

Gene name 5' to 3' forward primer 5' to 3' reverse primer Annealing temperature
MGMT tcttcaccatcccgttttcc attgcctctcattgctcctc 60°C
BRCA1 gctcgctgagacttcctg gataaatccatttctttctgttcc 60°C
ERCC1 tcagtcaacaaaacggacagtcag tccttgggttctttcccagagc 60°C
GSTP1 aacatgaggcgggcaag gttgtagtcagcgaaggag 60°C
XPD aagcaggagggcgagaag cctcatagaatcggcagtgg 59°C
HPRT agactttgctttccttggtcagg gtctggcttatatccaacattcg 60°C
Beta2-microglobulin cgctactctctctttctggc agacacatagcaattcaggaat 60°C