Skip to main content

Table 2 Primers and TaqMan probes for qRT-PCR

From: A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatment

Gene name Reference Primer sequence (5' to 3')a Probe numberb
KIAA0247 NM014734 F: CTGCAGATTCAGAGAACAGTGAC 82
   R: CTCATGCTTCTTTCAACAGTGG  
Cyclin A2 NM001237 F: CCATACCTCAAGTATTTGCCATC 67
(CCNA2)   R: TCCAGTCTTTCGTATTAATGATTCAG  
Cyclin B1 NM031966 F: CATGGTGCACTTTCCTCCTT 18
(CCNB1)   R: AGGTAATGTTGTAGAGTTGGTGTCC  
Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA 4
(CCNB2)   R: TGTAATACTGCTGCTTTAAGTTCCA  
  1. a F, forward primer; R, reverse primer.
  2. b Probe number, from the Human Universal Probe Library of Roche Diagnostics, Mannheim, Germany.