Skip to main content

Table 1 Primer and oligo sequences for PCR, ribozyme and amplification of full coding sequence of prostate transglutaminase (TGase-4)

From: Prostate transglutaminase (TGase-4) antagonizes the anti-tumour action of MDA-7/IL-24 in prostate cancer

  Sense (5' -'3) AntiSense (5' - '3)
TGase-4 expression Atgatggatgcatcaaaaga Ctacttggtgatgagaacaatcttctga
TGase-4 (position 62) Atggatgcatcaaaagagc Aggtgaaacacctgtcctc
(Aactgaacctgaccgtacaa ggtgaaacacctgtcctc [for Q-PCR])
TGase-4 (position 1957) Ataaaatgcaccccaataaa Ctacttggtgatgagaacaatc
(Actgaacctgaccgtacacc tacttggtgatgagaacaatc [for Q-PCR])
GAPDH Agcttgtcatcaatggaaat Cttcaccaccttcttgatgt
GAPDH for Q-PCR Ctgagtacgtcgtggagtc Actgaacctgaccgtacacagagatgatgacccttttg