Skip to main content

Table 1 List of Q-RT-PCR primers

From: High throughput RNAi assay optimization using adherent cell cytometry

Primer ID Sequence 5'-3'
MARCKS forward CGGCAGAGTAAAAGAGCAAGC
MARCKS reverse GGTTGTAGACAAGTTCTCCAAAAC
B2M forward CTCCACAGGTAGCTCTAGGAG
B2M reverse TCTGACCAAGATGTTGATGTTGG