Skip to main content

Table 1 Primer sequences used in this research.

From: Differentiation of breast cancer stem cells by knockdown of CD44: promising differentiation therapy

Gene Sequence GeXP PCR product (bp)
Multiplex 1: 17 genes (+ GAPDH and KanR)
Bcl-2 (B-cell lymphoma 2) F: AGGTGACACTATAGAATATGGAACTGTACGGCCCCAGCA 140
[Genebank:NM_000633] R: GTACGACTCACTATAGGGAAGGGTGATGCAAGCTCCCACCA  
Fos (FBJ murine osteosarcoma viral oncogene homolog) F: AGGTGACACTATAGAATAGTTATAAAAGCAGTGGCTGCGGC 153
[Genebank: NM_005252] R: GTACGACTCACTATAGGGAAGCACGGTCACTGCTCGTTCG  
ICAM1 (intercellular adhesion molecule 1) F: AGGTGACACTATAGAATAGTGCTATTCAAACTGCCCTGA 169
[Genebank:NM_000201] R: GTACGACTCACTATAGGGAGCGTAGGGTAAGGTTCTTGC  
CCND1 (cyclin D1) F: AGGTGACACTATAGAATAGCATGTTCGTGGCCTCTAAG 177
[Genebank: NM_053056] R: GTACGACTCACTATAGGGACAGGTTCCACTTGAGCTTGTT  
MMP7 (matrix metalloproteinase-7) F: AGGTGACACTATAGAATATTGGCTTTGCGCGAGGAGCT 181
[Genebank:NM_002423] R:GTACGACTCACTATAGGGACTGCTACCATCCGTCCAGCGT  
Myc (V-myc myelocytomatosis viral oncogene homolog (avian)) F: AGGTGACACTATAGAATACTCTCCTTGCAGCTGCTTAGA 187
[Genebank:NM_002467] R: GTACGACTCACTATAGGGACCTCGTCGCAGTAGAAATACG  
PRKCE (Protein kinase C epsilon type) F: AGGTGACACTATAGAATAAAGGTCCCTACCTTCTGCGA 197
[Genebank:NM_005400] R: GTACGACTCACTATAGGGACCAGTACTTTGGCGATTCCT  
TP53 (Cellular Tumor Antigen p53) F: AGGTGACACTATAGAATATTCCCTGGATTGGCAGCCAGACTG 201.5
[Genebank:NM_000546] R: GTACGACTCACTATAGGGATCCATTGCTTGGGACGGCAAGG  
VCAM1 (vascular cell adhesion molecule 1) F: AGGTGACACTATAGAATAAGGTGACGAATGAGGGGACCACATC 215.4
[Genebank:NM_001078] R: GTACGACTCACTATAGGGAAGCCTCCAGAGGGCCACTCAAA  
IL4R (IL-4 receptor) F: AGGTGACACTATAGAATAAAGTGGCACAACTCCTACAGG 231
[Genebank:NM_000418] R: GTACGACTCACTATAGGGACCCTGAGCATCCTGGATTATT  
PTCH1 (Protein patched homolog 1) F: AGGTGACACTATAGAATAGCCTTCGCTCTGGAGCAGATTT 240
[Genebank:NM_000264] R: GTACGACTCACTATAGGGAGTTGGTCTCGAGGTTCGCTGCTT  
HSPB1(heat shock 27 kDa protein 1) F: AGGTGACACTATAGAATAGCACACTGACCGTGGAGGCC 241
[Genebank: NM_001540] R: GTACGACTCACTATAGGGAGAACACACAGGTGGCGGGGG  
PTGS2 (prostaglandin-endoperoxide synthase 2) F: AGGTGACACTATAGAATACAGCTCCACAGCCAGACGCC 249
[Genebank: NM_000963] R: GTACGACTCACTATAGGGATCCTGTCCGGGTACAATCGCACT  
HSF1 (Heat shock factor protein 1) F: AGGTGACACTATAGAATAGCCTTCCTGACCAAGCTGTGGACC 271
[Genebank:NM_005526] R: GTACGACTCACTATAGGGATCTCTCTGGCTTGACCAGGCCG  
GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) F: AGGTGACACTATAGAATAAAGGTGAAGGTCGGAGTCAA 277.2
[Genebank:NM_002046] R: GTACGACTCACTATAGGGAGATCTCGCTCCTGGAAGATG  
LEF1 (Lymphoid enhancer-binding factor-1) F: AGGTGACACTATAGAATAGGTGCAGCCATCCCATGCGGT 290.2
[Genebank:NM_016269] R: GTACGACTCACTATAGGGAAGGGTTGCCTGAATCCACCCGTG  
TCF7 (Transcription factor 7) F: AGGTGACACTATAGAATAGGCGAGGAGCAGGACGACAAGAG 305
[Genebank:NM_003202] R: GTACGACTCACTATAGGGATTTGTACATGCCGCTGGTGCAC  
FASN (Fatty acid synthase) F: AGGTGACACTATAGAATAGAGTCGGAGAACTTGCAGGAGT 307
[Genebank:NM_004104] R: GTACGACTCACTATAGGGAGTGTGTTCCTCGGAGTGAATCT  
KanR (Kanamycin resistance) F: AGGTGACACTATAGAATAATCATCAGCATTGCATTCGATTCCTGTTTG 325.4
  R: GTACGACTCACTATAGGGAATTCCGACTCGTCCAACATC  
Multiplex 1: 5 genes (+ GAPDH and KanR)
Muc-1 (Mucin 1, transmembrane, transcript variant 1) F: AGGTGACACTATAGAATAGACGTCAGCGTGAGTGATGT 177.7
[Genebank:NM_002456] R: GTACGACTCACTATAGGGAGACAGCCAAGGCAATGAGAT  
Cyclin E2 (Cyclin E2 (CCNE2), transcript variant 3) F: AGGTGACACTATAGAATAGAGCCCGAAGAGCACTGAAAAACC 194.6
[Genebank:NM_004702] R: GTACGACTCACTATAGGGAGAGGAATTGGCTAGGGCAATCAA  
EGFR (EGF receptor, transcript variant 1) F: AGGTGACACTATAGAATAGAAAGGCAGCCACCAAATTA 208.4
[Genebank:NM_005228] R: GTACGACTCACTATAGGGAACTATCCTCCGTGGTCATGC  
Myc (V-myc myelocytomatosis viral oncogene homolog (avian)) F: AGGTGACACTATAGAATAGAGCAACGTCTCCACACATCAGCAC 217
[Genebank:NM_002467] R: GTACGACTCACTATAGGGAGAGTTTTGTGTGTTCGCCTCTTGAC  
Cyclin D1 (G1/S-specific cyclin-D1) F: AGGTGACACTATAGAATACGTGGCCTCTAAGATGAAGG 252.5
[Genebank:BC001501] R: GTACGACTCACTATAGGGATGCGGATGATCTGTTTGTTC  
GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) F: AGGTGACACTATAGAATAAAGGTGAAGGTCGGAGTCAA 277.2
[Genebank:NM_002046] R: GTACGACTCACTATAGGGAGATCTCGCTCCTGGAAGATG  
KanR (Kanamycin resistance) F: AGGTGACACTATAGAATAATCATCAGCATTGCATTCGATTCCTGTTTG 325.4
  R: GTACGACTCACTATAGGGAATTCCGACTCGTCCAACATC  
  1. F: Forward; R: Reverse.