Skip to main content

Table 1 Primer sequences for RT-PCR analysis.

From: A novel patient-derived intra-femoral xenograft model of bone metastatic prostate cancer that recapitulates mixed osteolytic and osteoblastic lesions

Oligo Name* Oligo Sequence (5' -- 3')*
h-PSA-F ACCATGTGGGTCCCGGTTGT
h-PSA-R GAGTTGATAGGGGTGCTCAGG
h-ARfl-F [66, 67] ACATCAAGGAACTCGATCGTATCATTGC
h-ARfl-R [66, 67] TTGGGCACTTGCACAGAGAT
h-ARv567es-F [66, 67] CCAAGGCCTTGCCTGATTGC
h-ARv567es-R [66, 67] TTGGGCACTTGCACAGAGAT
h-KRT5-F2 CACCAAGACTGTGAGGCAGA
h-KRT5-R2 CCTTGTTCATGTAGGCAGCA
h-KRT8-F [68] CCTCATCAAGAAGGATGTGGA
h-KRT8-R [68] CACCACAGATGTGTCCGAGA
h-KRT14-F [68] GACCATTGAGGACCTGAGGA
h-KRT14-R [68] ATTGATGTCGGCTTCCACAC
h-KRT18-F1 CCAGTCTGTGGAGAACGACA
h-KRT18-R1 CTGAGATTTGGGGGCATCTA
h-KRT18-F2 CCAGTCTGTGGAGAACGACA
h-KRT18-R2 ATCTGGGCTTGTAGGCCTTT
h-NKX3.1-F [46] GGCCTGGGAGTCTTTGACTCCACTAC
h-NKX3.1-R [46] ATGTGGAGCCCAAACCACAGAAAATG
h-AMACR-F [69] CGCGGTGTCATGGAGAAACT
h-AMACR-R [69] CTTCCTGACTGGCCAAATCC
h-GAPDH-F [70] GGTGGTCTCCTCTGACTTCAACA
h-GAPDH-R [70] TTGCTGTAGCCAAATTCGTTGT
m-Gapdh-F [71] TGTTCCTACCCCCAATGTGT
m-Gapdh-R [71] GGTCCTCAGTGTAGCCCAAG
TMPRSS2-ERG-F[72] TAGGCGCGAGCTAAGCAGGAG
TMPRSS2-ERG-R[72] GTAGGCACACTCAAACAACGACTGG