Table 2 List of qRT-PCR primersa and amplified Vβ gene(s).
Primer name | GenBank access number | Forward primer ('5 to 3') | Reverse primer ('5 to 3') | Amplified Vβ gene(s)b |
|---|---|---|---|---|
Cβ | L36092 | tccagttctacgggctctcg | gacgatctgggtgacgggt | |
VB1 | L36092 | ggagcaggcccagtggat | cgctgtccagttgctggtat | TCRVB1s1 |
VB2 | M11955 | gagtctcatgctgatggcaact | tctcgacgccttgctcgtat | TCRVB2s1 |
VB3 | U08314 | tcctctgtcgtgtggccttt | tctcgagctctgggttactttca | TCRVB3s1 |
VB4 | L36092 | ggctctgaggccacatatgag | ttaggtttgggcggctgat | TCRVB4s1 |
VB5 | L36092 | gctccaggctgctctgttg | tttgagtgactccagcctttactg | TCRVB5s1, 5s3 |
VB6 | X61440 | ggcagggcccagagtttc | gggcagccctgagtcatct | TCRVB6s1, 6s2, 6s3, 6s4, 6s5, 6s6 |
VB7 | U07977 | aagtgtgccaagtcgcttctc | tgcagggcgtgtaggtgaa | TCRVB7s1, 7s2, 7s3 |
VB8 | X07192 | tgcccgaggatcgattctc | tctgagggctggatcttcaga | TCRVB8s1, 8s2, 8s3 |
VB9 | U07977 | tgcccgaggatcgattctc | tctgagggctggatcttcaga | TCRVB9s1 |
VB11 | L36092 | catctaccagaccccaagatacct | atggcccatggtttgagaac | TCRVB11s1 |
VB12 | U03115 | gttcttctatgtggccctttgtct | tcttgggctctgggtgattc | TCRVB12s1, 12s3 |
VB13A | L36092 | tggtgctggtatcactgaccaa | ggaaatcctctgtggttgatctg | TCRVB13s1, 13s6 |
VB13B | X61445 | tgtgggcaggtccagtga | tgtcttcaggacccggaatt | TCRVB13s2, 13s9 |
VB14 | L36092 | gctccttggctatgtggtcc | ttgggttctgggtcacttgg | TCRVB14s1 |
VB15 | M11951 | tgttacccagaccccaagga | tgacccttagtctgagaacattcca | TCRVB15s1 |
VB16 | X06154 | cggtatgcccaacaatcgat | caggctgcaccttcagagtaga | TCRVB16s1 |
VB17 | U48260 | caaccaggtgctctgctgtgt | gactgagtgattccaccatcca | TCRVB17s1 |
VB18 | L36092 | ggaatgccaaaggaacgattt | tgctggatcctcaggatgct | TCRVB18s1 |
VB20 | L36092 | aggtgccccagaatctctca | ggagcttcttagaactcaggatgaa | TCRVB20s1 |
VB21 | M33233 | gctgtggctttttggtgtga | caggatctgccggtaccagta | TCRVB21s1 |
VB22 | L36092 | tgaaagcaggactcacagaacct | tcacttcctgtcccatctgtgt | TCRVB22s1 |
VB23 | U03115 | ttcagtggctgctggagtca | cagagtggctgtttccctcttt | TCRVB23s1 |
VB24 | U03115 | acccctgataacttccaatcca | cctggtgagcggatgtcaa | TCRVB24s1 |