Skip to main content

Table 1 List of qPCR primers

From: Development of a microarray platform for FFPET profiling: application to the classification of human tumors

Gene Name Primer Description Sequence
Ribosomal protein L13a RPL13a Forward CACTTGGGGACAGCATGAG
  RPL13a Reverse GTAACCCCTTGGTTGTGCAT
Glyceraldehyde-3 Phosphate Dehydrogenase GAPDH Forward AGTCCCTGCCACACTCAGTC
  GAPDH Reverse CTGTGAGGAGGGGAGATTCA
Amyloid beta precursor protein binding protein 1 APPBP1 Forward TCTTCGAGTGGTAAGATGTCGATCC
  APPBP1 Reverse ACCCGAAGGCAATTACAGTTTCAAT