Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 PCR primers used for MSP and bisulphite sequencing.

From: Hypermethylated MAL gene – a silent marker of early colon tumorigenesis

Primer set Sense primer Antisense primer Frg. Size, bp An. Temp Fragment location*
MAL MSP-M TTCGGGTTTTTTTGTTTTTAATTC GAAAACCATAACGACGTACTAACGT 139 56 -71 to 68
MAL MSP-U TTTTGGGTTTTTTTGTTTTTAATTT ACAAAAACCATAACAACATACTAACATC 142 56 -72 to 70
MAL BS_A GGGTTTTTTTGTTTTTAATT ACCAAAAACCACTCACAAACTC 236 53 -68 to 168
MAL BS_B GGAAAAATGAAGGAGATTTAAATTT AATAACCTAAACRCCCCC 404 50 -427 to -23
  1. Abbreviations: MSP, methylation-specific polymerase chain reaction; BS, bisulphite sequencing; M, methylated-specific primers; U, unmethylated-specific primers; Frg. Size, fragment size; An. Temp, annealing temperature (in degrees celsius). *Fragment location lists the start and end point (in base pairs) of each fragment relative to the transcription start point provided by NCBI (RefSeq ID NM_002371).