Skip to main content

Table 2 Primers used for SNPs

From: Haplotype of gene Nedd4 binding protein 2 associated with sporadic nasopharyngeal carcinoma in the Southern Chinese population

Number RefSNP(RS) (NCBI) Forward primers(5'→3') Reverse primer(5'→3') Product size (bp)
SNP1 RS17439810 agctgacagtgttcggctct ggtcaacatgatgtccgaaa 257
SNP2 loc123-e3l-snp2a    
SNP3 RS17511578 cttctcgtcctgggtctcc TGTCAGCTACAGCCAGTCCA 397
SNP4 RS17585937 acatgggccacaggaagtg aggcctgccagacacctg 266
SNP6 RS17511668-SNP2b TCTGTTCAATGCAAAATCCAA catcttGTGAAGGCAAAAATGA 389
SNP7 RS794001-SNP1c GCTTCATATATGCCAAGCATCA TTTTCTTCTTTTGTTTAAATCTGCATT 398
SNP9 RS2252352 agaTGCAGCTCAATCACCTA CAGAAGAAATTGCCTTACAGGA 300
SNP10 RS2271395 tccagtctagtcaaaatggtgaga aacacacagtgcaatttcttaactg 243
SNP11 RS1442855 TCATTTGCTTCAGCTTGTCA GGCCTTAAACCTTACTCCATCC 300
SNP12 RS2347044 TCTTGTGGTGAAATGTAGAATGC CCTGAGATTAACTACCCATATCAGC 368
  1. a Primers for loc123-e3l-snp2 are same as RS17439810.
  2. b primers for RS17511668-SNP2 are same as RS17511668
  3. c RS794001-SNP1 are same as RS794001.