Skip to main content

Table 1 List of primers used in this study

From: CD34+ cells cultured in stem cell factor and interleukin-2 generate CD56+ cells with antiproliferative effects on tumor cell lines

  Sequences  
  Sense Anti-Sense Transcript
Perforin cggctcacactcacagg ctgccgtggatgcctatg 369
Granzyme B ggggaagctccataaatgtcacct tacacacaagagggcctccagagt 431
NKp30 cagggcatctcgagtttccgacatggcctggatgctgttg gatttattggggtcttttgaag 606
NKp44 tacttcaaagtgtggcag tcacaaagtgtgttcatcatc 751
NKp46 aaaagcaagtgaccatct aagaacatgcttgttgcagt 337
NKp80 caagatgaagaaagataca gagaaccatccacccaagt 568
NKG2D gaaggcttttatccacaa ttacacagtcctttgcat 761
  1. NKp30 NKG2D sense12, perforin and granzyme B11have been already described