Skip to main content

Table 2 Primers used in this study

From: The expression of TGF-β1, Smad3, phospho-Smad3 and Smad7 is correlated with the development and invasion of nonfunctioning pituitary adenomas

Gene Forward Sequence (5′-3′) Reverse sequence (5′-3′)
Smad2 ATCCTAACAGAACTTCCGCC CTCAGCAAAAACTTCCCCAC
Smad3 GGAGAAATGGTGCGAGAAGG GAAGGCGAACTCACACAGC
Smad4 GCATCGACAGAGACATACAG CAACAGTAACAATAGGGCAG
Smad7 GAATCTTACGGGAAGATCAACCC CGCAGAGTCGGCTAAGGTG
TGF-β1 CCCTGGACACCAACTATTGC TGCGGAAGTCAATGTACAGC
PCNA ACTAACTTTTGCACTGAGGTACC GTATTTTAAGTGTCCCATATCCGC
GAPDH GAAGGTCGGAGTCAACGGATT CGCTCCTGGAAGATGGTGAT