Skip to main content

Advertisement

Table 1 Intron spanning primers for qRT-PCR analysis

From: In vitro blood cell responsiveness to IFN-α predicts clinical response independently of IL28B in hepatitis C virus genotype 1 infected patients

Gene Sense Antisense
RPS15 CGGACCAAAGCGATCTCTTC CGCACTGTACAGCTGCATCA
MxA GGTGGTGGTCCCCAGTAATG ACCACGTCCACAACCTTGTCT
OAS GAAGCCCTACGAAGAATGTCAGA TCGGAGTTGCCTCTTAAGACTGT
PKR TCTCAGCAGATACATCAGAGATAAATTCT AGTATACTTTGTTTCTTTCATGTCAGGAA