Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Nucleotide sequences of oligonucleotide primers used for PCR and sequencing of KRAS

From: Detection of activated KRAS from cancer patient peripheral blood using a weighted enzymatic chip array

   Sequences PCR product (bp)
Gene Exon Forward primer (5′ → 3′) Reverse primer (5′ → 3′)  
KRAS 1 TAATACGACTCACTATAGGGAGATATGTTGAGGGCCCATCTCTC TCCTAGGTCAGCGCAACCAAAT 131
KRAS 2 TAATACGACTCACTATAGGGTTCCTACAGGAAGCAAGTAG CACAAAGAAAGCCCTCCCCA 148
Sequencing primer CCCTATAGTGAGTCGTATTA