Skip to main content

Advertisement

Table 1 Nucleotide sequence of the primers used in this study

From: Laminin 411 acts as a potent inducer of umbilical cord mesenchymal stem cell differentiation into insulin-producing cells

  Gene Sequence (5′-3′)
1 Pdx1 F GGAGCCGGAGGAGAACAAG
Pdx1 R CTCGGTCAAGTTCAACATGACAG
2 Pax4 F CAGCGCTGCTGGACTT
Pax4 R CAGCGCTGCTGGACTT
3 Insulin F ACCAGCATCTGCTCCCTCTA
Insulin R GGTTCAAGGGCTTTATTCCA
4 Ngn3 F CTATTCTTTTGCGCCGGTAGA
Ngn3 R CTCACGGGTCACTTGGACAGT
5 Glucagon F CCCAAGATTTTGTGCAGTGGTT
Glucagon R CAGCATGTCTCTCAAATTCATCGT
6 Foxa2 F CTGAGCGAGATCTACCAGTGGA
Foxa2 R CAGTCGTTGAAGGAGAGCGAGT
7 Sox17 F GCATGACTCCGGTGTGAATCT
Sox17 R TCACACGTCAGGATAGTTGCAGT
8 GAPDH F GCACCGTCAAGGCTGAGAAC
GAPDH R TGGTGAAGACGCCAGTGGA
  1. F: forward primer; R: reverse primer.