Skip to main content

Table 1 The Sequences of primers for Real-Time PCR used in the study

From: Enhanced circulating PCSK9 concentration by berberine through SREBP-2 pathway in high fat diet-fed rats

Gene description Primer Sequences (5' → 3')
LDLR F GATTGGCTATGAGTGCCTATGTC
  R GTGAAGAGCAGAAACCCTATGG
SREBP-2 F AGCATACCGCAAGGTGTTCC
  R CCAGGTGTCTACTTCTCCGTGT
HNF1 F ATGACACGGATGACGATGGG
  R ATGGGTCCTCCTGAAGAAGTGA
GAPDH F ACAGCAACAGGGTGGTGGAC
  R TTTGAGGGTGCAGCGAACTT
  1. PCR = polymerase chain reaction; F = forward; R = reverse; LDLR = low density lipoprotein receptor; PCSK9 = proprotein convertase subtilisin/kexin type 9; SREBP-2 = sterol regulatory element binding protein-2; HNF1 = Hepatocyte Nuclear Factor 1; GAPDH = reduced glyceraldehyde-phosphate dehydrogenase.