Skip to main content

Advertisement

Table 1 Oligonucleotide sequences

From: MicroRNA-124-3p inhibits cell migration and invasion in bladder cancer cells by targeting ROCK1

Namea Sequence (5′ to 3′)b
miR-124-3p mimics (sense) UAAGGCACGCGGUGAAUGCC
NC (sense) ACUACUGAGUGACAGUAGA
siROCK1 (sense) GAAGAAACAUUCCCUAUUCTT
U6-F TGCGGGTGCTCGCTTCGGCAGC
ROCK1-F AACATGCTGCTGGATAAATCTGG
ROCK1-R TGTATCACATCGTACCATGCCT
miR-124-3p-F TAAGGCACGCGGTGAATGCC
GAPDH-F ACAACTTTGGTATCGTGGAAGG
GAPDH-R GCCATCACGCCACAGTTTC
ROCK1-utr-F CGTTGCATTGTCCTTTTAGTGCCTTA ATTTGAGATAATTATTTTACG
ROCK1-utr-R TCGACGTAAAATAATTATCTCAAATTAAGGCACTAAAAGGACAATGCAACGAGCT
ROCK1-mut-F CGTTGCATTGTCCTTTTACACGGAAT ATTTGAGATAATTATTTTACG
ROCK1-mut-R TCGACGTAAAATAATTATCTCAAATATTCCGTGTAAAAGGACAATGCAACGAGCT
  1. aF, forward primer; R, reverse primer.
  2. bTarget sites are in italic type; Mutated target sites are underlined.