Skip to main content

Table 1 Genes used for quantification and primer information

From: Oxidative stress and apoptosis in a pig model of brain death (BD) and living donation (LD)

Acc. number Forward primer (5' – 3') Reverse primer (5' – 3') Product length
HPRT1 (Hypoxanthine phosphoribosyltransferase)  
NM_001032376 GGACTTGAATCATGTTTGTG CAGATGTTTCCAAACTCAAC 91 bp
BAX (BCL2-associated X protein)  
XM_003127290 GCTGACGGCAACTTCAACTG CCGATCTCGAAGGAAGTCCA 141 bp
BCL2L1 (BCL2-like 1)  
NM_214285.1 TGAGTCGGATCGCAACTTGG ATCGGTTGAAGCGTTCCTGG 150 bp
GPX3 (Glutathione peroxidase 3)  
NM_001115155.1 GAGACAACTCGGAGATTCTG GGAACGTGTAGAACTTCTGC 126 bp
GSS (Glutathione synthetase)  
NM_001244625.1 AAGAAGCTGCCAAGATCCTC ATTCTCTATGGCACGCTGGT 155 bp
NFKB1 (Nuclear factor of kappa light polypeptide gene enhancer in b-cells)  
NM_001048232.1 GAGGTGCATCTGACGTATTC CACATCTCCTGTCACTGCAT 138 bp
OXSR1 (Oxidative-stress responsive 1)  
NM_214342.1 CCGAAGTTATGGAACAGGTC GATCATTCTGCAGTGTCAGC 147 bp
PPARA (Peroxisome proliferators-activated receptor- alpha)  
NM_001044526.1 TGAAGTTCAATGCGCTGGAG TTGAGCACATGCACGATACC 139 bp
HSP70.2 (Heat shock protein 70.2)  
NM_213766.1 AGGTGCAGGTGAGCTACAAG CTGCGAGTCGTTGAAGTAGG 158 bp
SOD2 (Superoxide dismutase 2, mitochondrial)  
NM_214127 CCTACGTGAACAACCTGAAC GATACAGCGGTCAACTTCTC 247 bp