Skip to main content

Table 1 The sequences of the primers

From: Innate immunity activation involved in unprotected porcine auto-transplant kidneys preserved by naked caspase-3 siRNA

Gene name   Primer sequence
β-actin Sense CTCGGTCAGGATCTTCATGAGG
  Antisense TTCTACAATGAGCTGCGTGTGG
IL-1β Sense TCATCGTGGCAGTGGAGAAGC
  Antisense TCTGGGTATGGCTTTCCTTAG
IL-6 Sense ATCTGGGTTCAATCAGGAGAC
  Antisense CTAATCTGCACAGCCTCGAC
TNF-α Sense AACCCTCTGGCCCAAGGA
  Antisense GGCGACGGGCTTATCTGA
IFN-α Sense TGGTGCATGAGATGCTCCA
  Antisense GCCGAGCCCTCTGTGCT
IFN-β Sense AGTGCATCCTCCAAATCGCT
  Antisense GCTCATGGAAAGAGCTGTGGT
IFN-γ Sense CATGAACACCATCAAGGAACAAAT
  Antisense TTTGAATCAGGTTTTTGAAAGCC
NF-κB Sense CCCATGTAGACAGCACCACCTATGAT
  Antisense ACAGAGGCTCAAAGTTCTCCACCA
c-Jun Sense TATGAGGAACCGCATCGCTG
  Antisense TAGCATGAGTTGGCACCCACTG