Skip to main content

Table 1 The real-time RT-PCR primers used in this study

From: Integrated wall stress: a new methodological approach to assess ventricular workload and myocardial contractile reserve

Target Sequence (5′-3′) Pro. Size
ANP AGGAGAAGATGCCGGTAGAAGA 67
  GCTTCCTCAGTCTGCTCACTCA  
BNP TGCTTTGGGCACAAGATAGA 122
  AGACCCAGGCAGAGTCAGAA  
Col I GCG AGT GCT GTG CTT TCT G 68
  TCC CTC GAC TCC TAC ATC TTC  
Col III CCCAACCCAGAGATCCCATT 73
  GAAGCACAGGAGCAGGTGTAGA  
GAPDH TGCACCACCAACTGCTTAGC 77
  GTGGTCATGAGCCCTTCCA