Skip to main content

Table 2 Primers for real time PCR

From: The altered expression profile of microRNAs in cardiopulmonary bypass canine models and the effects of mir-499 on myocardial ischemic reperfusion injury

Assay name Forward Primer(5' to 3') Reversed Primer(5' to 3')
cfa-miR-451 AGCCGGTAAACCGTTACCAT CAGTGCAGGGTCCGAGGTAT
cfa-miR-423 CTGTTGTGAGGGGCAGAGAG CAGTGCAGGGTCCGAGGTAT
cfa-miR-23 GGACGTCATCACATTGCCAG CAGTGCAGGGTCCGAGGTAT
cfa-miR-133 GGTGTTTGGTCCCCTTCAAC CATAAGCCAGCGCGATCAG
cfa-miR-489 GGCGCTGGTGACATCACAT CAGTGCAGGGTCCGAGGTAT
cfa-miR-574 TGTCACGCTCATGCACACA CAGTGCAGGGTCCGAGGTAT
cfa-miR-214 TTGGACAGCAGGCACAGACA CAGTGCAGGGTCCGAGGTAT
cfa-miR-1 TTGCGCTGGAATGTAAAGAAG CAGTGCAGGGTCCGAGGTAT
cfa-miR-494 CGGGTGAAACATACACGGGA CATAAGCCAGCGCGATCAG
cfa-miR-499 AGGCCGGTTAAGACTTGCAGT CATAAGCCAGCGCGATCAG
human-RNU6B CAAATTCGTGAAGCGTTCCATA AGTGCAGGGTCCGAGGTATTC