Skip to main content

Table 1 Primers for reverse transcription of microRNAs

From: The altered expression profile of microRNAs in cardiopulmonary bypass canine models and the effects of mir-499 on myocardial ischemic reperfusion injury

No. Assay name Gene Bank/miRbase Access No. Primers for reverse transcriptase Sequence(5' to 3')
1 cfa-miR-451 MIMAT0009870 AAACCGUUACCAUUACUGAGUU
2 cfa-miR-423 MIMAT0006742 UGAGGGGCAGAGAGCGAGACUUU
3 cfa-miR-23 MIMAT0006640 AUCACAUUGCCAGGGAUUU
4 cfa-miR-133 MIMAT0009835 UUUGGUCCCCUUCAACCAGCUA
5 cfa-miR-489 MIMAT0009860 GUGACAUCACAUAUACGGCGGC
6 cfa-miR-574 MIMAT0006673 CACGCUCAUGCACACACCCACA
7 cfa-miR-214 MIMAT0009847 ACAGCAGGCACAGACAGGCAGU
8 cfa-miR-1 MIMAT0006656 UGGAAUGUAAAGAAGUAUGUA
9 cfa-miR-494 MIMAT0009905 UGAAACAUACACGGGAAACCUC
10 cfa-miR-499 MIMAT0006655 UUAAGACUUGCAGUGAUGUUU
Control human-RNU6B NR_002752