Skip to main content

Advertisement

Table 1 Sequences of specific primer pairs

From: A Lectin-EGF antibody promotes regulatory T cells and attenuates nephrotoxic nephritis via DC-SIGN on dendritic cells

  Forward Reverse
IFN-γ 5′-AACCAGGCCATCAGCAACAAC A -3′ 5′-ACCGACTCCTTTTCCGCTTCCT-3′
TNF-α 5′-GGTGATCGGTCCCAACAAGGA -3′ 5′-CACGCTGGCTCAGCCACTC-3′
IL-6 5′-ATATGTTCTCAGGGAGATCTTGGA A-3′ 5′-GTGCATCATCGCTGTTCATACA-3′
IL-4 5′-AACACCACGGAGAACGAGCTC ATC-3′ 5′- AGTGAGTTCAGACCGCTGACACCT -3′
Foxp3 5′-CCCAGGAAAGACAGCAACCTT -3′ 5′- CTGCTTGGCAGTGCTTGAGAA -3′
IL-10 5′-GCCAAGCCTTGTCAGAAATGA -3′ 5′- TTTCTGGGCCATGGTTCTCT -3′
TGF-β 5′-ACCGGGTGGCAGGCGAGAG -3′ 5′- CGGGACAGCAATGGGGGTTCT -3′
GAPDH 5′-AGGACCAGGTTGTCTCCTGT -3′ 5′- TTACTCCTTGGAGGCCATGT -3′