Skip to main content

Advertisement

Table 1 Primer sequences, NCBI gene ID and amplicon size

From: Expression of gamma-aminobutyric acid receptors on neoplastic growth and prediction of prognosis in non-small cell lung cancer

Gene NCBI gene ID   Sequence(5′—3′) Amplicon size (bp)
GABRA3 2556 Sense CCGTCTGTTATGCCTTTGTATT 165
   Antisense TGTTGAAGGTAGTGCTGGTTTT  
GABRB3 2562 Sense GGAGATACCCCCTGGACGAGCA 196
   Antisense GGATAGGCACCTGTGGCGAAGA  
GABRE 2564 Sense ATGCTTCTCCTAAACTCCGCC 248
   Antisense CTTAAAACGCTTGCACCACTC  
GABRP 2568 Sense CGACCGTGTTATCAATGACC 120
   Antisense CCCCAAACACAAAGCTAAAGCA  
GABBR1 2550 Sense CAGATAAATGGATTGGAGGGT 101
   Antisense GAGAACTGAGACGGAGATAAAGAG  
GABBR2 9568 Sense GAGTCCACGCCATCTTCAAAAAT 108
   Antisense TCAGGATACACAGGTCGATCAGC  
18S rRNA 100008588 Sense GCAATTATTCCCCATGAACG 123
   Antisense GGCCTCACTAAACCATCCAA