Skip to main content

Table 1 Primer sequences

From: Nitric oxide augments mesenchymal stem cell ability to repair liver fibrosis

Primers Forward reverse
αSMA CTGACAGAGGCACCACTGAA AGAGGCATAGAGGGACAGCA
Collagen1α1 GCCAAGAAGACATCCCTGAA GGCAGAAAGCACAGCACTC
TIMP CATCTGGCATCCTCTTGTTG CTCGTTGATTTCTGGGGAAC
NFкB GCACCTGTTCCAAAGAGCAC GTGGAGTGAGACATGGACACAC
Albumin CGACTATCTCCAGCAAACTG GTCTCAGCAACAGGGATACA
β-Actin ACTGCTCTGGCTCCTAGCAC ACATCTGCTGGAAGGTGGAC