Skip to main content

Advertisement

Table 1 Primer sequences of various genes

From: Pre-conditioned mesenchymal stem cells ameliorate renal ischemic injury in rats by augmented survival and engraftment

Genes Primer sequence
BCL-2 Forward, 5′-CGACTTTGCAGAGATGTCCA-3′
  Reverse, 5′-ATGCCGGTTCAGGTACTCAG-3′
VEGF Forward, 5′-GCCCTGAGTCAAGAGGACAG-3′
  Reverse, 5′-GAGGAGGAGGAGCCATTACC-3′
IGF1 Forward, 5′-GCTGAAGCCGTTCATTTAGC-3′
  Reverse, 5′-CCACCCAGTTGCTATTGCTT-3′
PCNA Forward, 5′- GACCTCGCTCCCCTTACAGT -3′
  Reverse, 5′- TCCAGCACCTTCTTCAGGAT -3′
SDF-1α Forward, 5′- AGCCAGTCAGCCTGAGCTAC-3′
  Reverse, 5′- GGCACAGTTTGGAGTGTTGA-3′
HIF-1α Forward, 5′-CTAGGGATGCAGCACGATCT–3
  Reverse, 5′-AGATGGGAGCTCACGTTGTG–3′
AKT 1 Forward, 5′-CCTCAAGAACGATGGCACCT-3′
  Reverse, 5′-CAGGCAGCGGATGATAAAGG-3′
β-Actin Forward, 5′- GCTGTGTTGTCCCTGTATGC-3′
  Reverse, 5′- GAGCGCGTAACCCTCATAGA-3′