Skip to main content

Table 1 Comparison of primers and genomic coordinates used in this study for methylation-specific PCR in comparison to Herman et al.[7]

From: Characterization of CDKN2A(p16) methylation and impact in colorectal cancer: systematic analysis using pyrosequencing

   Position/AB060808.1 Position / Start codon Sequence
CDS p16/CDKN2A exon 1 192221- > 192072 0 - > 149 ATGGAGCCGG…..GCCGATCCAG
This study F1 192197- > 192176 24 - > 45 ATGGAGCCTTCGGCTGACTGGC
  R1_primer 192050- > 192033 171 - > 188 CCCGCCATCCCCTGCTCC
  R2_primer 192077- > 192060 144 - > 161 CCCTCTACCCACCTGGAT
Herman F1 192301- > 192278 −80 - > −57 TCACCAGAGGGTGGGGCGGACCGC
  R1 192172- > 192151 49 - > 70 TTAACAAAAAAAAAAAACTAAACTCCTC